NGS Service

Lab Service / R&D> NGS Service

Research & Development Center

Novogene Service

Novogene

Reliable and high quality NGS data is a key component in genomics research. At Novogene, we use the most effective technology available from world leading providers including Illumina NovaSeq 6000, HiSeq, Oxford Nanopore, Ion Torrent and PacBio Sequel platforms. Over the years our NGS labs have developed optimized NGS processes and protocols to ensure the best possible scientific outcome for your research.

Not only do we offer state of the art NGS technology, we also have the largest sequencing capacity in the world with an annual throughput of over 280,000 human WGS samples.

Sequencing Platform

ILLUMINA
NovaSeq 6000

Introduced by Illumina in January 2017, the NovaSeq Sequencer provides tremendous scalability and flexibility to accommodate diverse applications and project sizes, for virtually any sequencing method, genome, and scale of project. The NovaSeq sequencer extends applications previously unavailable on HiSeq X Ten, such as expression profiling, whole transcriptome analysis, microbial genome, WES, low pass WGS, etc., while accommodating rapid turnaround, flexible configurations and cost effectiveness. The addition of these NovaSeq sequencers not only expands Novogene’s sequencing capacity, but also greatly reduces our sequencing turnaround time. With the NovaSeq, we are able to sequence up to 48 human whole genomes and produce 6Tb of data per single run as short as 40 hours. System specifications: 850G raw data per lane, 3.4T raw data per Flowcell and 2 x 150 bp read length; 800M raw reads per Flowcell and 2 x 250 bp & 2 x 50 bp reads length;

ILLUMINA

PACBIO
PacBio Sequel II/IIe System

The PacBio Sequel System is the SMRT sequencing platform that provides ultra-long sequencing reads with high consensus accuracy, uniform coverage, and simultaneous epigenetic characterization at single-molecule resolution. The PacBio Sequel System provides 7x more throughput, more scalability, and lower sequencing costs than the PacBio RS II System, while maintaining the same benefits. With the addition of the PacBio Sequel Systems that Novogene acquired in early 2017, Novogene now has the world’s largest SMRT sequencing capacity.

PACBIO

NANOPORE PLATFORM
Nanopore PromethION

Oxford Nanopore Technologies offers real-time, long-read, direct and large-scale sequencing of DNA or RNA. Novogene acquired Nanopore PromethION System, the most updated version of Nanopore sequencers with the highest throughput, in 2018. The PromethION system sequences DNA or RNA by Nanopore reader proteins embedded in an electrically resistant membrane. Ultra-long reads span repeat regions in complicated genomes easily, and enhance accuracy of genome assembly and large structure variation detection enormously..

Nanopore PromethION

Genome Sequencing

Whole Genome Sequencing

Whole Genome Sequencing is an instrumental technique that is commonly being employed to sequence the entire genomes of animals and plants, respectively, and aims at identifying genomic variations such as SNP, InDel, CNV, and SV. Whole Genome Sequencing is an ideal approach to determine the entirety of genetic information at a single nucleotide level.

Animal and Plant WGS Specifications: DNA Sample Requirements

Platform Type Sample Type Amount (Qubit®) Purity
Illumina

NovaSeq 6000

Genomic DNA ≥ 200 ng A260/280=1.8-2.0;

no degradation,
no contamination

Genomic DNA

(PCR free non-350bp)

≥ 5 μg
Genomic DNA

(PCR free -350bp)

≥ 1.2 μg
PacBio Sequel II
DNA CLR library
HMW Genomic DNA ≥ 8 μg A260/280=1.8-2.0;
A260/230=1.5-2.6;
*NC/QC=0.95-3.00
Fragments should be ≥ 40 kb
PacBio sequel II
DNA HiFi library
HMW Genomic DNA ≥ 15 μg A260/280=1.8-2.0;
A260/230=1.5-2.6;
*NC/QC=0.95-3.00
Fragments should be ≥ 30 kb
Nanopore PromethION HMW Genomic DNA ≥ 8 μg A260/280=1.8-2.0;
A260/230=1.5-2.6;
Fragments should be ≥ 30 kb

*NC/QC: NanoDrop concetration/Qubit concentration

Animal and Plant WGS Specifications: Sequencing and Analysis

Platform Type Illumina NovaSeq 6000 PacBio Sequel II/IIe Nanopore PromethION
Read Length Paired-end 150 bp Average > 15 kb Average > 17 kb
Recommended

Sequencing Depth

For SNP/InDel detection: ≥ 10× For SV detection: ≥ 20×
For SV/CNV detection: ≥ 20×
Content of

Analysis

Standard Analysis

  • Data quality control
    • Sequencing error rate
    • Filtering reads containing adapter or with low quality
  • Alignment with reference genome
    • Statistics of mapping, sequencing depth and coverage
  • SNP calling, annotation and statistics

Advanced Analysis

  • SV calling, annotation and statistics
  • CNV calling, annotation and statistics
Standard Analysis

  • Data quality control
  • Sequencing alignment
  • Structural Variant (SV) detection

Whole Exome Sequencing

Whole exome sequencing (WES) employs next-generation sequencing technology (NGS), which provides a cost-efficient alternative to whole genome sequencing (WGS). The human whole exome, composed by about 180,000 exons (protein-coding region of the genome) accounts for only 1-2% of the human genome, but up to 85% of the disease-related mutations associated with Mendelian disorders occur in these regions

hWES Specifications: DNA Sample Requirements

Platform Type Sample Type Amount (Qubit®) Purity
Illumina NovaSeq 6000 Genomic DNA ≥ 300 ng A260/280 = 1.8-2.0;
no degradation,no contamination
cfDNA/ctDNA ≥ 30 ng Fragments should be in multiples of 170 bp,
with no genomic
contamination
Genomic DNA from FFPE tissue ≥ 500 ng Fragments should be ≥ 1000 bp

Note: Values of sample amount are only listed for your reference. Download the Service Specifications and Sample Requirements to learn more. For detailed information, please contact us with your customized requests.

hWES Specifications: Sequencing and Analysis

Sequencing Platform Illumina NovaSeq 6000
Read Length Paired-end 150 bp
Sequencing Depth
For Mendelian disorder/rare disease: effective sequencing depth above 50× (6G)
For tumor sample: effective sequencing depth above 100× (12G)
Data Analysis
  • Data quality control
  • Alignment to a reference genome
  • SNP and InDel calling
  • Somatic SNP/InDel/CNV mutation detection (tumor-normal paired samples)

Transcriptome Sequencing

mRNA Sequencing (mRNA-seq)

RNA sequencing (RNA-seq) has been transforming the study of cellular functionality, which provides researchers with an unprecedented insight into the transcriptional landscape of cells. Employing the high-throughput and accurate next-generation sequencing technique (NGS), RNA-seq reveals gene expression profiles and describes the continuous variations in the transcriptome. In the RNA-seq technique, the single-stranded messenger RNAs (mRNAs) are selectively captured or enriched, and converted to complementary DNA (cDNA) for library preparation.

mRNA-seq Specifications: Sample Requirements

Library Type Sample Type Amount RNA Integrity Number (Agilent 2100) Purity (NanoDrop)
Eukaryotic RNA-Seq (cDNA library) Total RNA 10 Kb for Sequel Inaverage > 15 Kb for Sequel II"}">≥ 200 ng ≥ 4.0, with smooth base line A260/280 = 1.8-2.2
A260/230 ≥ 1.8
Total RNA (Blood) ≥ 400 ng ≥ 5.8, with smooth base line
Amplified cDNA (double-stranded) ≥ 100 ng Fragments between 400bp and 5000bp with main peak at ~2000bp A260/280 = 1.8-2.0
A260/230 ≥ 1.8
Eukaryotic RNA-Seq (strand specific library) Total RNA ≥ 400 ng ≥ 5.8, with smooth base line A260/280 = 1.8-2.2
A260/230 ≥ 1.8

Note: Sample amounts are listed for reference only. Download the Service Specifications or Sample Requirements to learn more. For detailed information, please contact us with your customized requests.

mRNA-seq Specifications: Sequencing and Analysis

Sequencing Platform Illumina NovaSeq 6000 Sequencing System
Read Length Paired-end 150 bp
Data Output
  • ≥ 20 million read pairs per sample for species with reference genome
  • ≥ 50 million read pairs per sample for species without reference genome (de novo transcriptome assembly projects)
  • Data Analysis Capability
  • Data Quality Control
  • Gene expression quantification
  • Differential expression profiling
  • Functional enrichment analysis
  • Novel transcripts identification
  • SNP & InDel analysis
  • Alternative splicing (AS) analysis
  • Fusion gene prediction
  • Protein-Protein Interaction (PPI) analysis
  • Transcription factors and oncogene functional annotation
  • Non-coding RNA Sequencing

    lncRNA Sequencing

    Long non-Long non-coding RNAs (lncRNAs) are a moderately abundant fraction of the eukaryotic transcriptome, which are comprised of longer than 200nt non-coding RNAs (ncRNAs) , including lincRNAs (intergenic lncRNAs), intronic, anti-sense, sense and bidirectional lncRNAs, which do not encode proteins. Effects of lncRNAs show evidence on multiple cellular functions and perform as prime targets on the regulation of gene transcription, post-transcriptional modifications, and epigenetics. lncRNA sequencing (lncRNA-seq) is a powerful NGS tool to study functional roles in diverse biological processes and human diseases, such as cancer and neurological disorders.

    Small RNA Sequencing

    Small RNAs (sRNAs) are short RNA molecules, usually non-coding, involved with gene silencing and the post-transcriptional regulation of gene expression. sRNA Sequencing (sRNA-seq) is a method that enables the in-depth investigation of these RNAs, in special microRNAs (miRNAs, 18-40nt in length).

    Circular RNA Sequencing

    Circular RNA (circRNA) is a highly stable molecule of ncRNA, in form of a covalently closed loop that lacks the 5’end caps and the 3’ poly(A) tails. The circular structure grants to circRNAs resistance against exonuclease digestion, a characteristic that can be exploited in library construction.

    Epigenome Sequencing

    Whole Genome Bisulfite Sequencing

    DNA methylation at the C5 position of cytosine plays a crucial role in gene expression and chromatin remodeling. Perturbations in methylation patterns are associated with tumorigenesis, neurodegenerative diseases and neurological disorders. Bioinformatic analysis of methylome is widely used in various research areas, including studies on gene regulation, cell differentiation, embryogenesis, aging, occurrence and development of disease, phenotypic diversity and evolution in plants and animals.

    WGBS Specifications: DNA Sample Requirements

    Sample Type Required Amount Purity
    Genomic DNA ≥ 200 ng A260/280=1.8-2.0

    Note: Sample amounts are listed for reference only. Download the Service Specifications or Sample Requirements to learn more. For detailed information, please contact us with your customized requests.

    WGBS Specifications: Sequencing and Analysis

    Platform Type Illumina NovaSeq 6000
    Read Length Paired-end 150 bp
    Sequencing Depth ≥ 30× coverage for the species with reference genome
    Standard Data Analysis
  • Data Quality Control
  • mCs detection, methylation level calculation
  • Methylation level and frequency distribution
  • Differentially Methylated Site (DMS) detection
  • Differentially Methylated Regions (DMRs), Differentially Methylated Promoter (DMPs) detection and annotation
  • Function enrichment of DMR-associated genes and DMP-associated genes
  • Visualization of BS seq data
  • Comparative analysis (among samples)
  • Chromatin Immunoprecipitation Sequencing (ChIP-seq)

    Chromatin Immunoprecipitation Sequencing (ChIP-seq) provides genome-wide profiling of DNA targets for histone modification, transcription factors, and other DNA-associated proteins. It combines the selectivity of chromatin immuno-precipitation (ChIP) to recover specific protein-DNA complexes, with the power of next-generation sequencing (NGS) to achieve high-throughput sequencing of the recovered DNA.

    ChIP-seq Specifications: DNA Sample Requirements

    Sample Type Required Amount Fragment size Purity
    Enriched DNA Sample ≥ 20 ng (Concentration ≥ 2 ng/μL) 100 bp~500 bp A260/280=1.8-2.0

    Note: Sample amounts are listed for reference only. Download the Service Specifications or Sample Requirements to learn more. For detailed information, please contact us with your customized requests.

    ChIP-seq Specifications: Sequencing & Analysis

    Platform Illumina NovaSeq 6000
    Read Length Pair-end 150 bp
    Sequencing Depth ≥ 20 million read pairs per sample for the species with reference genome
    Standard Data Analysis
    • Data Quality Control
    • Mapping onto reference genome
    • Peak calling
    • Motif prediction
    • Peak annotation and functional analysis of peak-associated genes
    • Summary of differential peaks and functional analysis of differential peak related genes
    • Visualization of ChIP-seq data

    Reduced Representation Bisulfite Sequencing (RRBS)

    Reduced Representation Bisulfite Sequencing (RRBS) detects millions of novel CpG sites based on the improved bisulfite sequencing method, providing coverage to approximately all gene promoters, CpG islands, gene bodies, repetitive DNA sequences, and regulatory elements. It is an NGS-based sequencing platform and combines bisulfite sequencing and restriction enzymes to analyze the genome regions containing high CpG content. This combination allows reduced representation bisulfite sequencing to enhance the efficacy of the sample utilization and provides a perfect platform for clinical applications and pilot research.

    RRBS Specifications: DNA Sample Requirements

    Sample Type Required amount Purity
    Genomic DNA ≥ 1 μg A260/280=1.8-2.0

    RRBS Specifications: Sequencing and Analysis

    Sequencing Platform Illumina NovaSeq 6000 Sequencing System
    Read Length Paired-end 150 bp
    Recommended Data Amount ≥ 10 Gb clean data per sample
    Content of Data Analysis
    • Data quality control
    • MspⅠ cutting efficiency
    • Alignment to the reference genome
    • mC-calling
    • Methylation level and frequency distribution
    • DMS detection
    • DMRs and DMPs detection and annotation
    • Enrichment analysis of differentially methylated genes
    • Visualization of BS seq data

    RNA Immunoprecipitation Sequencing (RIP-seq)

    RNA immunoprecipitation sequencing (RIP-seq) is a high-throughput RNA sequencing method widely used to study Protein-RNA interactions to detect RNA interactions with the target proteins. The coupling of RIP-seq with other sequencing technologies enables the detection of a large number of RNA-protein complexes in a single run. RIP-seq provides deep insights not only into the central dogma (i.e., transcription and translation) but also in recent research areas like gene regulation by ncRNAs and RNA interference.

    RIP-seq Specifications: RNA Sample Requirements

    Sample Type Required Amount Peaks Distribution Purity
    Enriched RNA Sample ≥ 100 ng
    (Concentration ≥ 3 ng/μL)
    For unfragmented sample,
    fragment should be ≥ 1000 bp.
    A260/280>2.0

    RIP-seq Specifications: Sequencing and Analysis

    Sequencing Platform Illumina NovaSeq 6000 Sequencing System
    Read Length Paired-end 150bp
    Recommended Data Amount ≥ 20 million read pairs per sample for the species with a reference genome
    Content of Data Analysis

    16S/18S/ITS Amplicon Metagenomic Sequencing

    16S/18S/ITS Amplicon Metagenomic Sequencing is an ultra-deep DNA sequencing method that focuses on sequencing specific target regions (amplicons). Short (<500bp) hypervariable regions of conserved genes or intergenic regions are amplified by PCR and analyzed by next generation sequencing (NGS) technology, to identify and differentiate multiple microbial species from complicated samples. Amplicon metagenomic sequencing is designated to sequence the target genes of 16S ribosomal RNA (rRNA), or 18S rRNA and Internal Transcribed Spacer (ITS) rRNA by universal primers, to describe and compare the phylogeny and taxonomy of bacteria (and archaea) and fungi (such as yeasts, moulds and etc.), respectively.

    Primers applied to Amplicon Metagenomic Sequencing

    Types Amplified Region Fragment Length Primers Sequences (5’- 3’)
    Bacterial 16S V4 300 bp 515F GTGCCAGCMGCCGCGGTAA
    806R GGACTACHVGGGTWTCTAAT
    V3-V4 470 bp 341F CCTAYGGGRBGCASCAG
    806R GGACTACNNGGGTATCTAAT
    V4-V5 450 bp 515F GTGCCAGCMGCCGCGGTAA
    907R CCGTCAATTCCTTTGAGTTT
    V5-V7 (for endophytic) 435 bp 799F AACMGGATTAGATACCCKG
    1193R ACGTCATCCCCACCTTCC
    Archaeal 16S V4-V5 400-500 bp Arch519F CAGCCGCCGCGGTAA
    Arch915R GTGCTCCCCCGCCAATTCCT
    Types Amplified Region Fragment Length Primers Sequences (5’- 3’)
    Fungal 18S V4 350 bp 528F GCGGTAATTCCAGCTCCAA
    706R AATCCRAGAATTTCACCTCT
    Fungal ITS ITS1 200-400 bp ITS5-1737F GGAAGTAAAAGTCGTAACAAGG
    ITS2-2043R GCTGCGTTCTTCATCGATGC
    ITS2 380 bp ITS3-2024F GCATCGATGAAGAACGCAGC
    ITS4-2409R TCCTCCGCTTATTGATATGC
    ITS1-1F (for endophytic) 200-400 bp ITS1-1F-F CTTGGTCATTTAGAGGAAGTAA
    ITS1-1F-R GCTGCGTTCTTCATCGATGC

    Amplicon Specifications: DNA Sample Requirements

    Sample Type Amount Volume Concentration Purity
    Genomic DNA ≥ 200 ng ≥ 20 μL ≥ 10 ng/μL A260/280 = 1.8-2.0

    Amplicon Specifications: Sequencing and Analysis

    Sequencing Platform Illumina NovaSeq 6000
    Read Length Paired-end 250 bp
    Data Output 30K/50K/100K raw tags
    Standard Data Analysis
    • OTUs cluster and phylogenetic relationship construction
    • Species annotation

    • Alpha & Beta diversity analysis
    • Ternary plot
    • NMDS & LefSE analysis
    • Metastats analysis
    • Species T-test analysis
    • MRPP, ANOSIM, PERMANOVA, AMOVA analysis
    • Comparative analysis of alpha and beta diversity indices

    Shotgun Metagenomic Sequencing

    Shotgun metagenomic sequencing provides information on the total genomic DNA from all organisms in a sample, avoiding the need for isolation and cultivation of microorganisms or amplification of target regions. This is crucial because it is believed that nearly 99% of all microorganisms cannot be cultivated in the laboratory. Differently from the targeted approach used in the 16S/18S/ITS amplicon sequencing, shotgun metagenomic sequencing uses next-generation sequencing (NGS) technology to provide not only information on the taxonomic annotations of each organism but also the functional profiling, gene prediction and microbial interaction of the whole community.

    Metagenomic Specifications: DNA Sample Requirements

    Sample Type Amount Volume Concentration Purity
    Genomic DNA ≥ 200 ng ≥20 μL ≥ 10 ng/μL A260/280 = 1.8-2.0

    Note: Sample amounts displayed are for reference only. Download the Service Specifications or Sample Requirements to learn more. For detailed information, please contact us with your customized requests.

    Metagenomic Specifications: Sequencing and Analysis

    Sequencing Platform Illumina NovaSeq 6000
    Read Length Pair-end 150 bp
    Recommended Sequencing Depth ≥ 40 million read pairs per sample for species with reference genome
    Standard Data Analysis
    • · Data Quality Control
    • · De novo Assembly
    • · Gene Functional Annotation
    • · Comparative Analysis between multiple samples